Import your data (5.3 version and above) - LabCollector

Knowledge Base

Search Knowledge Base by Keyword

Import your data (5.3 version and above)

You are here:
← All Topics
Accessible to ALL users except User and Visitor level permission

 Prepare your LabCollector database. Before importing data, you have to configure the module you are importing data by creating the fields that you need and adding possible values where required. See our KB-Create custom field 5.2v for more information on creating custom fields.
Ensure your PHP has increased limits: max_input_vars = 10000 or more (See KB-Import large files).

Go to: ADMIN > Data > Import and choose the module where you want to import your data (one file per module).

 Data import only works with CSV or another text file with delimited data (except for sequences and molecules importing) and not directly from Excel (expect if you copy/paste your data, see below point 2), Access or other software. You can convert your data to text format (text file with DOS line break) with field delimiters of your choice from Excel or other database types. For Mac OS files, save them as CSV for Windows format.

Strain & Cells – Samples – Reagent & Supplies – Antibodies – Plasmids – Primers – Animals – Equipment – Address Book – Custom modules

Choose one of the modules above and follow these steps.

1. You can use different files to import your data: two such files are offered by LabCollector containing all the fields in the module of your choice either with legend title tags or database name title tags in CSV format; otherwise you can create your own file with the names of your fields in the order you prefer. However, the field names must match the exact names as they are in one of LabCollector’s files.
The legend name is the name of the field in the module record, form or in the list of fields in the default/custom fields areas that you give to the field. The database name is available in the default/custom fields areas and exempted of special characters.


Organize your file to have all the fields you want to import. The first line corresponds to the field names. One field by column.

Imported data MUST CONTAIN fields related to name (if you have set up your module with Automatic naming, leave the column empty) and owner (unless you select to overwrite imported owners in advanced options – see below – or the module doesn’t use the owner field as in the Reagent & Supplies module).
Save this file in txt (Tab) or CSV (comma or semi-colon as separator).

2. Upload your file or copy/paste the lines you want to import, ALWAYS with the first line corresponding to the field names.
Copy/paste from excel is really easy: select the cells you want to paste and copy them in the field, don’t forget the headers!

3. Choose the field separator. If you copy/paste from Excel, select the TAB separator.

4. Check your data before choosing to confirm. You can discard the import if there is a mistake.

Advanced options:
On the top right, tick the box to open the options section.

A. By default, the characters are encoding with ISO-8859-1. That allows you to import most special characters such as letters with grave, acute, diaeresis, circumflex… UTF-8 has to be used for some language (e.g. Chinese, Greek…) if you use software allowing you to save in CSV with UTF-8 as encoding (for example LibreOffice).

B. If your excel file doesn’t have Owner/Main Operator/Person in Charge/Author (depending on the module – Reagents & Supplies and Address Book modules don’t have owner fields), or if you want to overwrite this field, select one owner in the list. Administrators can import data under any name. Staff can import under their own name only. Note: As of version 5.4 the Owner field is an optional field in Reagents & Supplies.

C. You can choose to import into a waiting list. As for the mode user, an administrator has to validate the data under ADMIN > Data > Waiting list. 

D. If you have configured your equipment with the automatic storage option, you can access this storage directly here. You don’t have the choice of the box/location, LabCollector assigns all storage automatically.

During step 2, you have the possibility to check the import result before the final validation.

  • If there is no error in your file, you can confirm the import.

  • If you forgot the owner column or forgot to select one owner in the select list under Advanced options, you will get this error message

  • If you use an owner who is not in the lab member list or make a mistake, you will get this error message

  • If you forgot the name column or chose the wrong field separator, you will get this error message

  • If your module is set up as Block duplicates under ADMIN > Preferences > Records options and you import the same name twice, you will get this message

  • Checkbox and select list can be imported. The value needs to match the exact values in LabCollector. If the value used in the import file is wrong, you will get this message. If you choose to import, the wrong value will not be imported.

  • Multiple select list and checkbox field types can contain multiple values. The value needs to match the exact values in LabCollector and be separated by | (CTRL+ALT+6) or a colon (:). Don’t introduce space before and after the separator. If the value used in the import file is wrong, you will get the message below. If you choose to import, the wrong value will not be imported.

  • “Link to” and autocomplete fields can be imported. For “Link to” field, the value in your file needs to match the exact name of the record in LabCollector and be separated by | (CTRL+ALT+6) or a colon (:). Don’t introduce space before and after the separator. If a value used in the import file is wrong, the wrong value will not be imported. Autocomplete field is a text field, if the name of the record exists, a link is created; if not, the text is available

  • New version 5.41! The import system allows detecting uniqueness for Optional unique code field and custom field with the uniqueness option activated.

 Each imported record can have a project code. Each project code used must already exist in LabCollector for a correct importation.

 Custom fields such as Database Upload and Disk Folder Upload cannot be imported. Please use the free add-on Custom field file upload.

 The date has to be formatted as yyyy-mm-dd or yy-mm-dd, for more details please read the KB-Formatting date value.


Genotype

Genotype tags need to be separated by a space.

Sequences


You can upload directly your .FASTA file (not .fas) formatted like:

>FN598458.1 Uncultured phyllopharyngid ciliate partial 18S rRNA gene, clone GM2_C8
ACCTGGTTGATCCTGCCAGTAGCATATGCTTGTCTTGGAGATTAAGCCATGCATGTCTAAGTATAAGTTA
TACAAGGCGAAACTGCGAATGGCTCATTAAAACAGTTATAATTTATTTGACGATTGCCTTATATGGATAA
CCGAGGGAAACTTCAGCTAATACATGCTTGTCATTTGACGTATTTATTAGTTCCACCGATGGCTTAGGCC
TTTTGATGATTCATGATAACTGATCGAAGCGATTTCGCTACGTCATTCAAGTTTCTGCCCTATCAGCTCT
GATTGTAGTGTATTGGACTACAATGGCTATTACGGGTAACGGAGAATTAGGGTTCGATTCCGGAGAAGGA
GCCTGAGAAACGGCTACTATGTCTACGGATAGCAGCAGGCGCGTAAATTACCCAATTGTAAATCACAGAG

and choose DNA, RNA or Protein type. You also have to choose the owner of the import sequences (by default, the person associated with the account login).

When you proceed to step 2, you get:

Note: You can also import sequences from GenBank through Sequences module.


Chemical Structures
For MOL and SDF file format, your file has to be formatted with 3 headers lines or optional tags (indicate the number of tags)

For CDX file format, you can upload multiple files or ZIP files.

Step 2 result:


Documents
Upload your file as for other modules. You can also associate your documents with the records.


Add the column original_file_name containing the exact name of the document you want to import to your import file or paste lines as in the example below.
Then, upload your import file AND all the documents you want to import (multiple files as below or a zip).

In step 2, you can check the name of your documents.

Result in the database after import: