Import your data (v6.0) - LabCollector

Knowledge Base

Search Knowledge Base by Keyword

Import your data (v6.0)

You are here:
← All Topics
Accessible to ALL users except User and Visitor level permission

Prepare your LabCollector database. Before importing data, you have to configure the module you are importing data by creating the fields that you need and adding possible values where required. See our KB-Create custom field 5.2v for more information on creating custom fields.
Ensure your PHP has increased limits: max_input_vars = 10000 or more (See KB-Import large files).

Important points to remember for import data module:

Before importing your data you need to organize the data as described below.

  • Data import only works with CSV or another text file with delimited data (Click the link to check our KB to delimit data)
  • Save the csv file in txt (Tab) or CSV (comma or semi-colon as separator). (Click the link to check our KB on how to save in csv format)
  • You can convert your data to text format (text file with DOS line break) with field delimiters of your choice from Excel or other database types.
  • For Mac OS files, save them as CSV for Windows format.
  • All mandatory fields (with *) present in the module in LabCollector should be included. (See figure below under Fields Name–>Method 1)
  • Do not merge cells in csv. They will be considered as separate cells & will create error

  • In your csv file the headings of the column (Column names) should be same as the field names (Admin–>Data–>Fields order and select the module you want to see or reorder fields for). [Checking/editing Field Names is described below]

  • You can download the Field names to copy-paste them in your csv file (as column headings) to be imported. (shown in Section A-Import data into modules below).
  • One field name should be one column.
  • Imported data MUST CONTAIN fields related to name (if you have set up your module with Automatic naming, leave the column empty) and owner (unless you select to overwrite imported owners in advanced options – see second figure under section A – or the module doesn’t use the owner field as in the Reagent & Supplies module).
    * to go to Automatic Naming go to Admin –>Other–>Record Options

Related KBs:-

For any excel sheet to be imported the column name should be the same as field name to be imported so to check the field name, there are three methods. All of them are explained in detail below.

 

Method 1:

Go to a module and clicking on “Add new record”.

For example: – In PCR custom module click on.

Method 2:

a) You can edit the Field names by going to Admin–>Data–>Default Fields.

 

 

b) Admin–>Data–>Custom Fields.

 

Method 3:
You can go to Admin–>Data–>Fields Order and reorder the Fields.

 

You can import data into: 
A) Any Modules (custom or default)
Some default modules have specific configuration and the import function is described for:
B) Genotype field in Strains & Cells, Animal Module; Under default fields, general options, the Genotype tag system
C) Sequences
D) Chemical structures
E) Documents and R&S (Check this KB)

All of them are explained below.

A) IMPORT DATA INTO MODULES

For example we made a Custom Module: PCR

Check our KB on how to create custom module

 

 

The below page will be displayed with several options.
Do not forget to click on “Advanced Options” if you want to edit special features. (green arrows)

 

  • This option allows you to download the field names which are present inside the specific selected You can download either the Legend names or the Database names. Legend and database names are shown in images under Method 2.
    *Legend name is the name of the field in the module record, form or in the list of fields in the default/custom fields areas that you give to the field.
    *Database name is available in the default/custom fields areas and exempted of special characters.
  • Either you can upload the csv file or copy paste the data from the csv file.
    -Upload: You have to delimit the data in your csv another KB with the ‘comma’ (,) or a semicolon (;). For English Microsoft office its comma (,) and for French Microsoft office its semicolon (;).
    -Copy Paste: copy the area of the csv along with the column headings and paste it.
  • You can upload the selected csv file
  • Choose the field separator.
    If you copy/paste from Excel, select the TAB separator.
    If you have uploaded then it is a comma (English) & semi-colon (French) language csv.
    *The advance options will be shown if on the top right the box near the “Advance option” is tick marked. (green arrows in the above image)
  • By default, the characters are encoded with ISO-8859-1. That allows you to import most special characters such as letters with grave, acute, diaeresis, circumflex, etc.
    UTF-8 has to be used for some language (e.g. Chinese, Greek…) if you use software allowing you to save in CSV with UTF-8 as encoding (for example LibreOffice).
  • You can select if you have separated the columns by colon (:) or a tab (│)
  • If your excel file doesn’t have Owner/Main Operator/Person in Charge/Author (depending on the module – Reagents & Supplies and Address Book modules don’t have owner fields), or if you want to overwrite this field, select one owner in the list.
    *Administrators can import data under any name.
    *Staff can import under their own name only.
  • CSV columns are positioned according to the top as A1, B1, C1….and so on. If you are using a numeric position for your csv file, which means that the column A1= 1, B1=2…and so on. In this case you can tick mark this option for “Use Numeric Box position”.
  • You can choose to import into a waiting list. As for the mode user, an administrator has to validate the data under ADMIN > Data > Waiting list. 
  • If you have configured your equipment with the automatic storage option, you can access this storage directly here. You don’t have the choice of the box/location, LabCollector assigns all storage automatically.

If everything is ok click on proceed to step 2 & click on confirm.

Custom field to add link to any module

If you have a custom field that allows you to insert a link to any module, and you want to import data from csv and specify the module you need to link to your record.
You have 2 options to link the Module or the Record:

1. To specify the module in your csv you can add  MODULE_CODE-ID

For example, if you want to link your Primer records to specific record in Sample Module. You have to add the 2 letter code for the module, for samples it is SP and then the ID of the record you want to link the primer information to.

 

To find ID for standard/Default Modules you can go to the particular module, click on the barcode of any record and check the Module ID. (highlighted in yellow in the below image)


 

Default Module IDs with 2 letter format are:-

To find ID for custom modules you can go to the Admin–> Custom Modules.

 

2. You can also create a auto-complete field type in the custom fields. For example like below.

In this case you can link the Module by the specific record name.

You can encounter some errors while importing data. Check our KB to see the errors and their fixing solution

Other important points to remember for import data module:

  • Each imported record can have a project code. Each project code used must already exist in LabCollector for a correct importation. (to manage project codes go to Tools–>Manage project codes )
  • Custom fields such as Database Uploadand Disk Folder Upload cannot be imported. Please use the free add-on Custom field file upload.
  • The date has to be formatted as yyyy-mm-dd or yy-mm-dd, for more details please read the KB-Formatting date value.

B) IMPORT DATA INTO MODULES-Genotype

If you have a custom module genotype you can import data. Genotype tags need to be separated by a space.

C) IMPORT DATA INTO MODULE-Sequences

You can import the sequences file in the fasta format. For example like below:

>FN598458.1 Uncultured phyllopharyngid ciliate partial 18S rRNA gene, clone GM2_C8
ACCTGGTTGATCCTGCCAGTAGCATATGCTTGTCTTGGAGATTAAGCCATGCATGTCTAAGTATAAGTTA
TACAAGGCGAAACTGCGAATGGCTCATTAAAACAGTTATAATTTATTTGACGATTGCCTTATATGGATAA
CCGAGGGAAACTTCAGCTAATACATGCTTGTCATTTGACGTATTTATTAGTTCCACCGATGGCTTAGGCC
TTTTGATGATTCATGATAACTGATCGAAGCGATTTCGCTACGTCATTCAAGTTTCTGCCCTATCAGCTCT
GATTGTAGTGTATTGGACTACAATGGCTATTACGGGTAACGGAGAATTAGGGTTCGATTCCGGAGAAGGA
GCCTGAGAAACGGCTACTATGTCTACGGATAGCAGCAGGCGCGTAAATTACCCAATTGTAAATCACAGAG

Once the file is uploaded you choose DNA, RNA or Protein type. You also have to choose the owner of the import sequences (by default, the person associated with the account login).

Select to proceed to step 2 once everything is ok.

D) IMPORT DATA INTO MODULE-Chemical Structures

To import the chemical files, you can import them in the MOL, SDF & CDX file formatted.

For MOL and SDF file format, your file can to be formatted with headers lines. You can also add tags if you require.

 

For CDX file you can upload multiple files or a ZIP file.

 

D) IMPORT DATA INTO MODULE- Documents

You can upload documents using a csv as well.
You can either upload the csv or copy-paste the items in the csv file.
For copy pasting remember Add the column original_file_name containing the exact name of the document you want to import to your import file or paste lines as in the example below. Remember to add the file extension also under the original_file_name as seen in the figure below (eg. if it is a pdf write under original name IF_Microtubule.pdf). Then, upload your import file AND all the documents you want to import (multiple files as below or a zip).

 

Once everything is ok you can proceed to step 2:

 

Result in database after import